Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YE16FM1
Length(NT) : 537
Best Gene Model Blast : Link to GSTUMT00000021001 E-value : 1e-111
Numbers of ESTs : 1

Blast Results:

Nr Definition: elongation factor 1-a
Accession: gb|AAQ08239.1|AF516773_1 Score: 843 E_value: 6e-89
KEGG Definition: ELONGATION FACTOR 1-ALPHA (EF-1-ALPHA)
Accession: ncr:NCU02003.1 Score: 772 E_value: 5e-81
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0458 Score: 448 E_value: 1e-45
PFAM Definition: GTP_EFTU, Elongation factor Tu GTP binding domain. This domain contains a P-loop motif, also found in several other families such as pfam00071, pfam00025 and pfam00063. Elongation factor Tu consists of three structural domains, this plus two C-terminal beta barrel domains..
Pfam Number: pfam00009 Score: 296 E_value: 6e-28
Swissprot: Q01765|EF1A_PODCU

Sequence:
>SY0AAB61YE16FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCCCCCCGGACATCGTGACTTTATCAAGAACATGATTACTGGTA
CCTCCCAGGCCGATTGCGCCATCCTTATCATCGCTGCCGGCACTGGTGAG
TTCGAGGCTGGTATTTCCAAGGATGGCCAGACCCGTGAACACGCCCTTCT
CGCATACACCCTTGGTGTCAAGCAACTTATCGTTGCTATCAACAAGATGG
ACACTACCAAGTGGTCGGAGGACCGCTTTAAGGAAATCGTCAAGGAAACC
TCCAACTTTATCAAGAAGGTCGGATTCAACCCCAAGTCGGTTGCCTTCGT
CCCTATCTCTGGTTTCAACGGCGACAACATGATCGATGCTTCTTCCAACT
GCCCCTGGTACAAGGGATGGGACAAGGAGACCAAGGCCGGGAAGTCCTCT
GGAAAGACCCTTCTTGACGCCATTGATGCCATCGAGCCCCCAAGTCGTCC
TTCCGATAAACCTCTTCGTCTCCCTCTCCAGGACGTC

Sequences in the Contig:

SY0AAB61YE16FM1