Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YE03FM1
Length(NT) : 615
Best Gene Model Blast : Link to GSTUMT00008931001 E-value : 1e-157
Numbers of ESTs : 1

Blast Results:

Nr Definition: endo-1,3-beta-glucanase Eng1
Accession: ref|NP_593162.1| Score: 169 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: spo:SPAC821.09 Score: 169 E_value: 6e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9UT45|ENG1_SCHPO
Gene Ontology:
GO:0043187 = Cellular component: cell septum surface
GO:0009986 = Cellular component: cell surface
GO:0042973 = Molecular function: glucan endo-1,3-beta-D-glucosidase activity
GO:0016998 = Biological process: cell wall catabolic process
GO:0009313 = Biological process: oligosaccharide catabolic process
GO:0030994 = Biological process: primary cell septum disassembly

Sequence:
>SY0AAB61YE03FM1
TTGGCATACACAAGCCAAATCACAAGTCCTTCACTTGCCTCTTTCCATTC
AATCGTTCATCTCCCTTCTAAATCAACCAAAAGAAACCTATATAACACCT
CCCTCCACAACCCAGATTCCAAAAGAAAATGCAGTTCACAACCTATGTCC
TCGCAACCTTCACCCTCATCTCGGCCGCATTGGCAAGCCCCGTTAACAAC
CTAGTCGAGCGCCAGCTTCAGTACTGCGGTACCCAGCCATATTACCCTCA
GGACGTATCTCACCCCTCCCTCCCTCACCCGCAATCGCGCTTCACACGAC
CATATCACTGAGACTAAAAGGAATATACATGATAGTACACCTGCTACCCT
GCCAACAACAACCTCCTCTGCCCAATCAGCAACGGCGTTATCTTTCAGCC
ATGCGGACAAGCGTGCTTCGACCCGGCGAACTATGGTTGCGTCAATGGAC
AACTCGTGCCCGTTGGTAATTGCAATGGACAGGCCTATGATAAGAACTCT
TACGTCTGCGTGAGCAACCACCTCTGCCCAAAGACTCACCCGAACCTTTG
CGGCGAGGCTTGCTACAGCCTTAGCCAGTACCGCTGCAACAATGGACAAT
TGGTTCAAGTGTAAG

Sequences in the Contig:

SY0AAB61YE03FM1