Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YD12FM1
Length(NT) : 558
Best Gene Model Blast : Link to GSTUMT00007113001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein ATEG_07800
Accession: ref|XP_001216421.1| Score: 524 E_value: 6e-52
KEGG Definition: zinc/cadmium resistance protein; K03295 cation efflux system protein, CDF family
Accession: afm:AFUA_2G14570 Score: 504 E_value: 7e-50
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1483 Score: 465 E_value: 1e-47
PFAM Definition: Cation_efflux, Cation efflux family. Members of this family are integral membrane proteins, that are found to increase tolerance to divalent metal ions such as cadmium, zinc, and cobalt. These proteins are thought to be efflux pumps that remove these ions from cells..
Pfam Number: pfam01545 Score: 290 E_value: 3e-27
Swissprot: P32798|COT1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0015087 = Molecular function: cobalt ion transmembrane transporter activity
GO:0005385 = Molecular function: zinc ion transmembrane transporter activity
GO:0006882 = Biological process: cellular zinc ion homeostasis
GO:0006824 = Biological process: cobalt ion transport
GO:0006829 = Biological process: zinc ion transport

Sequence:
>SY0AAB61YD12FM1
ATCCTCCCATTCACATCAAAATCTCAACATGCGCGGAGTATTCCTCCACG
TCCTTGGTGATGCACTCGGAAACGTCGGCGTAATGTCAGTAGCCGGTGCT
CTCCTCCTCCTCCCAGAGACAATCTGGTGGCGCCACCTCCTAGATCCCTC
CATCTCCCTGCTCATCACAATGATAATCTTCTCCTCCGCTCTCCCACTCT
GCAAGTCGGCCTCCAAAATTTTACTTCAAGGTGTGCCTAAGGGAATCTCG
CTGGAGGAAGTGAAAGAAGATATCGCCTCGATCCAAGGCGTCGAATCCGT
CCACGAATTGCACATCTGGCAACTCAGCGACGTGAAAATGATCGCAAGTT
TGCACATCCAGATCGCCTTCGATCCAGAATGCGAAGGCGGTGGGCGATAC
ATGCAACTTGCAAACGCAGTCCGGACATGCCTGCATGCATATGGGATCCA
CTCGAGCACTATTCAGCCGGAATACACCAAAGAAGAGGAAGCGGCCGCGA
GTAGAACAGGCAGTACAAGAGGCGGCACAGAAGAAGAGGCGGCGTGTCTT
TTGGAATG

Sequences in the Contig:

SY0AAB61YD12FM1