Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YC04FM1
Length(NT) : 629
Best Gene Model Blast : Link to GSTUMT00005756001 E-value : 5e-84
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06991
Accession: ref|XP_001554403.1| Score: 355 E_value: 3e-32
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 305 E_value: 1e-26
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 220 E_value: 5e-19
PFAM Definition: No Hit Found
Swissprot: Q6F6B3|TANC1_RAT

Sequence:
>SY0AAB61YC04FM1
TTGGAAAAATGCTTTTAGAACGAGGGGATGTCAATCCCGACCAGGCAGAC
ACCAAATATGGCCGGACGCCACTCTTGTGGGCCGCTGGAAGCGGGCATCC
GGGGGTAGTGAAGATGCTTTTGGAACGAGGGGATGCCAATCCCAACCAGG
AGGAATATGGCGTGACGCCACTCTTGTTGGCCGTGGATAACGGGCATTCT
GGGGTAGTAAAGATGCTTTTGGAACGAGGGGATGTCAATCCCAACCAGGC
GGACACCAAATATGGCCGGACGCCACTCTCATGGGCGGCAGAGAACGGAA
ATGAGGTGGTAGTAAAGATGCTTTTAGAACGGAAAGATGTGCGCACCGCC
ACCCCAGATAACGCGAATCAAACGCCATTGTCGAGGGCTCTCTCTAGAGG
ACATAATCGGGTCGTAGTAATGTTACTTGAACGGGACGGTATGAGTTCTG
ACACAGCAGATCGTGTTGGCTAGAATCGCCTCCCGGCCTCCGTTGGGGTA
TGGGGGAGAGCGCGGCAGGTATGCCATTTAGAGACTCAATAAATTGGAAC
CAGTATCGGACCTCGAAGACTCCCAATTCCGCAGTTAGCGACATCCCCTC
GACTGAGCAGTCCGGACTTTTTCAACCCC

Sequences in the Contig:

SY0AAB61YC04FM1