Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB61YB14FM1
Length(NT) : 582
Best Gene Model Blast : Link to GSTUMT00008940001 E-value : 1e-170
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG00898.1
Accession: ref|XP_381074.1| Score: 340 E_value: 2e-30
KEGG Definition: hypothetical protein
Accession: fgr:FG00898.1 Score: 340 E_value: 8e-31
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1962 Score: 173 E_value: 1e-13
PFAM Definition: Bap31, B-cell receptor-associated protein 31-like. Bap31 is a polytopic integral protein of the endoplasmic reticulum membrane and a substrate of caspase-8. Bap31 is cleaved within its cytosolic domain, generating pro-apoptotic p20 Bap31..
Pfam Number: pfam05529 Score: 175 E_value: 6e-14
Swissprot: O14290|YF14_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>SY0AAB61YB14FM1
TTGGCCACGCTGCACAACCGAGTACGGGTTACTGTGCTTTGGATAAAAGT
TACAAAAAAAATCACTTAACTGTTTTTTCATAGCGAGCCATCATGACGCT
CTACTATTCTTTGGTATATATACCTTTTGCTACCCATCGTCCGATTGGGT
GGAGACGAGTTTGTTGTCTTTTCACGTACACGTTCACTCTACTCGAGTAC
TTTGCTCTATTGTTTTTACTGTGGAGCTGTGACGTAGTAAACAAACAAAC
AAACAACTTTGCTAACGGGATGCGTCTACGCAGGTATTTGTCTTACTCAT
GGTAGAGATGGCAGTCTACCTTCTCATGGTCTTACCGGTCCCGTACTCCC
CGAGGATGCGGTTTTTCACCTGGATTTCGACGAGTGCAGTTGTGGGAAAG
ATACAGTACTGTCTTAAGATTACCTTCGTCTTCATCTTGATCCTGTTCGT
CGACTCCGTCAACCGCGTCTACCGTGTTCAGTCCGAGCTCTCGGAGAGTA
AACATATGGGAGGTCAAAGCGTTATGGGACATGAACGCATGGAGGTTCAG
GCTAGGAAGTTCTATTCTCAGCGTAACATGTA

Sequences in the Contig:

SY0AAB61YB14FM1