Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YP20FM1
Length(NT) : 564
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62471.1| Score: 451 E_value: 2e-43
KEGG Definition: mitochondrial carnitine-acylcarnitine carrier protein
Accession: aor:AO090701000815 Score: 451 E_value: 1e-43
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0758 Score: 188 E_value: 2e-15
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 172 E_value: 2e-13
Swissprot: P32331|YMC1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005342 = Molecular function: organic acid transmembrane transporter activity
GO:0006839 = Biological process: mitochondrial transport

Sequence:
>SY0AAB60YP20FM1
TTGGGATCAATCTCTTTTGATTATTGTCGACACTTTGTTTCACGATTACA
ACAACTCTCACGTCCTCTTCCCATCAGCACAGCTGTCCGCCCGGCAAGAG
AATCGCCTCGCTCGCTTCGCTCGCTCGGCTCACCCGAACTCCAGAATGCT
AGGTTCGCTTGCTAACTACCGCGCGGCTATCAAGAGCAACGTTTATCCGC
AACACGCCACCCTTCCCTCCATCGGCCACGGAATGGCTGGTATTCTCGCC
GGGTGGACAGTGAGCTTTATAGCAGCACCTGTTGAGCACGTGAAGGCTCG
TCTACAGATTCAATATAACGCCAAAGGCTCCAACGCTGGTATCACGTACT
ACGGGCCAATCGACTGTACCAGAAAACTGCTCCATAACCACGGGATCCAA
GGTTTGTATCACGGTCTAGGTGCAACCATGTTCTTCCGCACGTACTTTTT
TTTCTGGTGGAGCTCCTACGACATCCTAACCCACCAGCTCGAGCAAAGAA
CCAACATGGCCCCTATGTTCGTGAATTTCTGGGCAGGCGGTCTAAGTGCG
AACCTATTCTGGCT

Sequences in the Contig:

SY0AAB60YP20FM1