Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YM10FM1
Length(NT) : 534
Best Gene Model Blast : Link to GSTUMT00005592001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001212772.1| Score: 283 E_value: 5e-24
KEGG Definition: hypothetical protein
Accession: ncr:NCU07036.1 Score: 256 E_value: 4e-21
KOG Definition: No Hit Found
PFAM Definition: 3_5_exonuc, 3'-5' exonuclease. This domain is responsible for the 3'-5' exonuclease proofreading activity of E. coli DNA polymerase I (polI) and other enzymes, it catalyses the hydrolysis of unpaired or mismatched nucleotides. This domain consists of the amino-terminal half of the Klenow fragment in E. coli polI it is also found in the Werner syndrome helicase (WRN), focus forming activity 1 protein (FFA-1) and ribonuclease D (RNase D). Werner syndrome is a human genetic disorder causing premature aging; the WRN protein has helicase activity in the 3'-5' direction. The FFA-1 protein is required for formation of a replication foci and also has helicase activity; it is a homologue of the WRN protein. RNase D is a 3'-5' exonuclease involved in tRNA processing. Also found in this family is the autoantigen PM/Scl thought to be involved in polymyositis-scleroderma overlap syndrome..
Pfam Number: pfam01612 Score: 117 E_value: 3e-07

Sequence:
>SY0AAB60YM10FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCAAAAAATGGCAGTCCCGCAATATACCCTCATAGAAACTCTCC
CTGCCCTGGCAGCCATGCTCAGTAGCATCTCAGATCTGCCCAACCACCCC
CCACCTCTTTACCTGGACCTCGAAGGCGAAAGACTCGGCCGTCATGGAAC
CATAGCTATCATACAGATACACGTCCTGCCTCAAAACCACACCTACCTTC
TCGACATCACAACTCTCGGACGGGAAGCTTTTACATTCCGGGAAAACCTC
CAAGCGAAAAATCTCAAGACGATCCTTGAGTCACCATCCATCACCAAGTG
CCTCTTTGACGTGCGTAACGATGCGGACGCTCTGTTCAACCTGTACGACA
TCTCCCTTCGAGGCGTGCAAGACATCCAAGTGATGAATTACGCTGCGAGA
GAAGTCCGCAACGGCGTGCGCGGGAGAGGGCCCCGCGTTATGGGGCTTGC
GAAGTCCATTGCTGCGGATTGTGGACTTAACAGG

Sequences in the Contig:

SY0AAB60YM10FM1