Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YL09FM1
Length(NT) : 514
Best Gene Model Blast : Link to GSTUMT00011894001 E-value : 1e-108
Numbers of ESTs : 1

Blast Results:

Nr Definition: 30 kDa heat shock protein
Accession: ref|XP_001247978.1| Score: 161 E_value: 4e-19
KEGG Definition: 30 kD heat shock protein
Accession: ani:AN3555.2 Score: 153 E_value: 5e-18
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0710 Score: 109 E_value: 3e-06
PFAM Definition: HSP20, Hsp20/alpha crystallin family..
Pfam Number: pfam00011 Score: 108 E_value: 3e-06
Swissprot: P40920|HSP30_EMENI

Sequence:
>SY0AAB60YL09FM1
TTGGCCGTCAGCGAAAACTTCAAAGCTCTCTCCAAAAGCACTTTCAAACC
TTACCAAAAATCTCCCAAACACCATTTCAAAAAGCATACTTCGACAAACC
ACAAAAACGAGGACAAAATGTCGCTTCTAAGGCAATACTCTGATATCTTC
AGTCTCCTTGACGATACCTCTCGCATACCCCAACGCACCAACCGCCGTGG
TGCCTTCTCCCCAAGCTTCGACGTTCACGAAACGGAACAAGCCTACGTCC
TCGAAGGCGAACTCCCAGGACTCCACGATAAGTCGAACCTAAGCATCGAG
TTCACCGACCCCCGGACAACGAACCCGCCATCGCCAAGAAAGACAAAAAA
GAGGTCCAGCAAGAAGCCAAGGGTGCCATCGAGGAGAAGGATAAAGATTC
CAGGCCCCGCTATTGGGTTTCGGAGCGCACGGTCGGCGAGTTCCAACGCA
GCTTCTCGTTCCCGAGTTATGTGGATATGGACGCCGTGAAGGCTAGTCTT
GCGCATGGGATTTT

Sequences in the Contig:

SY0AAB60YL09FM1