Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YK09FM1
Length(NT) : 587
Best Gene Model Blast : Link to GSTUMT00001733001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_05959
Accession: ref|XP_001796348.1| Score: 329 E_value: 4e-33
KEGG Definition: hypothetical protein
Accession: ang:An07g02770 Score: 361 E_value: 3e-33
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4149 Score: 263 E_value: 4e-24
PFAM Definition: No Hit Found
Swissprot: Q4IK03|MIA40_GIBZE
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>SY0AAB60YK09FM1
TTGGGGTTTCATAATCCTCCCCTACAGTTACGGCTAGGCAAATGTCGGTA
CTCAGGCCCGTTGGTCGGTCGCTTCTGGGCCGCCAGATCCTCTCGACACC
TGTGCGCCCTACAGTTCCAGCATTGCTACTAAATAATAGGTCACTTTTCA
CCCCCACTCCGGGGCAGAAGCGATCCAGCTTCAAGTCATTTGTTGCGAGG
TGGGCTGTGGCGGGTGGTTTGATTTACGCTCCCCCAGGATGAGCTGAAGA
CTATACCCCCCGAAGACCAGGACCGCCCAAAGTCATTGCTACCCGAGAAG
GGAGGGAAGTTGGGAAGGCGGCAGAGGTCGGACGCTGAGGATGATGGGCT
CTTGACCGCGGATGAGGCCCGAGGAGGACCGGAGGATTTGGAGGCTGAGG
CGGGACAAGAGGGGGCCTTTGATCCGGAGACTGGAGAGATTAATTGGGAT
TGCCCTTGTCTTGGTGGAATGGCTCATGGTCCTTGTGGGGAAGAGTTCAA
AACTGCTTTTAGTTGCTTCGTTTTTTCGAAGGAAGATCCTAAAGGCGTGG
ATTGTATTGAAAGGTTTAGGGATATGCAAACTTGCTT

Sequences in the Contig:

SY0AAB60YK09FM1