Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YK07FM1
Length(NT) : 449
Best Gene Model Blast : Link to GSTUMT00005844001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_00805
Accession: ref|XP_001560777.1| Score: 525 E_value: 3e-52
KEGG Definition: hypothetical protein
Accession: fgr:FG08766.1 Score: 522 E_value: 3e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9P7P0|YOL4_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAB60YK07FM1
TTGGGCTGATTGCTGGCGGGTTGCTGGTTCTGCCGCCAGAAAAGGGACAG
AGTGCGGCTAGTGCTGAGGTTACTGAGATATTGAGCGACGAGGAGGTCGT
GCTAAAAAGGGAGTTTAAGGGAGATATTGCCCTGGCACAGCTTACGCAGA
AAAGCGGGGAGGATGGGAATGGGAGCAAGTATAAGGTTGCGCCAAAGGTC
GATCAGAGTCAGGTCTATGATGCGGTGTTTCAGAGATTGAATTCCGGTGG
TTGTGTGGGTATATTTCCTGAGGGTGGTAGTCATGACAGAACGGAATTAT
TGCCATTAAAGGCTGGTGTTGCTATTATGGCGCTCGGTGCTCTCTCTGCC
AACCCAGATTGTGGACTCAAAATTGTGCCTTGTGGGTTGAATTATTTCCA
TGCTCATAAGTTCCGATCACGGGCTGTCATTGAGTTTGGAGCTCCGATT

Sequences in the Contig:

SY0AAB60YK07FM1