Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YK01FM1
Length(NT) : 444
Best Gene Model Blast : Link to GSTUMT00004508001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_08329
Accession: ref|XP_001798649.1| Score: 416 E_value: 1e-39
KEGG Definition: hypothetical protein
Accession: ang:An02g06070 Score: 387 E_value: 1e-36
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4159 Score: 321 E_value: 5e-31
PFAM Definition: LON, ATP-dependent protease La (LON) domain..
Pfam Number: pfam02190 Score: 112 E_value: 9e-07
Swissprot: Q9D4H7|LONF3_MOUSE

Sequence:
>SY0AAB60YK01FM1
CGCTCTCGAGAGATTAATGGACAAGGCTCGAGCGGATTTGGAGTGTCAGG
TTTGTTATGGAATGCTTTTGGATCCCGTCACCACTTATTGTGGCCATACT
TTCTGTCGTGGATGCTTGGAGCGGGTTTTGGACCATTCTCGACATTGTCC
TTCCTGCCGACGGTTGATGCACCTTCCATCTATCCTACCGGCACAGTCTA
GCAATAAGAGGCTAACAGAATTACTGGTGGGGTTATGCCCGGAGGCTCTG
TCCCAACGAGCATTGGCTGGGGCTATGGAGTCGATGGCTGGGAATGGTGA
TGGTGGACTGTCGACTCCAATATTTGTCTGTACGGCCTCTTATCCTGGAA
TGCCTACCCCTCTACATGTTTTTGAGCCTCGCTACAGACTCATGGTGCGA
CGAGCTTGTGAGAGTGGCGCAAGGAAATTCGGAATGTTGTTGCC

Sequences in the Contig:

SY0AAB60YK01FM1