Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YJ01FM1
Length(NT) : 497
Best Gene Model Blast : Link to GSTUMT00012134001 E-value : 1e-139
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An02g13810
Accession: ref|XP_001400512.1| Score: 486 E_value: 1e-47
KEGG Definition: hypothetical protein
Accession: ang:An02g13810 Score: 486 E_value: 6e-48
KOG Definition: No Hit Found
PFAM Definition: DOPA_dioxygen, Dopa 4,5-dioxygenase family. This family of proteins are related to a DOPA 4,5-dioxygenase that is involved in synthesis of betalain. DOPA-dioxygenase is the key enzyme involved in betalain biosynthesis. It converts 3,4-dihydroxyphenylalanine to betalamic acid, a yellow chromophore..
Pfam Number: pfam08883 Score: 336 E_value: 1e-32
Swissprot: P56739|Y212_BOTFU

Sequence:
>SY0AAB60YJ01FM1
CATCCTTCTACACTTACCCCTCCCCACTCGCTGGTTACAAGAACGAGCCT
CCTCTTCCAACAACTCTCAATGTGAACAATAGATCCCTTTACAATCCTGA
GACGGGAAACCTTAGCGCTGCATATGAGCAGTTTCCGGAGCCAATCGATA
ATGGACAGAATCCCGGGGGTTTTGATGTCCACGTTTACTTTTATCAGGTT
CGTCATTTGCATGTGGAAAGGGGTGGTGGAGGCTCACGCGAACCTGGATA
GAACAATCCCGAGCAGGTACAATTCGCAAAGGAATTATGGGAACGGGTTC
GGCGGGAATTTCCCGAACTCCGCATTTATAAAATTTTCGACAAGCCAATC
GGTCCCCATACCCTTGCGATGTTCGAGGTAAACATTCTAACTCCCACCCA
ATTCGGAGCATTCATACCCTGGCTTGTCGTAAACCGTGGTCCACTCAGCG
TCCTCCTTCACCCAAACACCGACGATCCACTCAGAGACCACACCCAA

Sequences in the Contig:

SY0AAB60YJ01FM1