Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YG14FM1
Length(NT) : 357
Best Gene Model Blast : Link to GSTUMT00004105001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57249.1| Score: 460 E_value: 1e-44
KEGG Definition: predicted protein carboxyl methylase
Accession: aor:AO090003000009 Score: 460 E_value: 5e-45
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1541 Score: 425 E_value: 2e-43
PFAM Definition: Methyltransf_11, Methyltransferase domain. Members of this family are SAM dependent methyltransferases..
Pfam Number: pfam08241 Score: 114 E_value: 3e-07
Swissprot: Q58DP0|WBS22_BOVIN

Sequence:
>SY0AAB60YG14FM1
AGTTGGCGAAGCCGGCCCTAATCGCCGCACCGGTAATCATCCCCCTCTGC
ACCTCATTCTTCGGATAGAACTGTAAGACAGCCTTCCCACCCCTCTTCAA
TGCGGCATACAGCCCCTCAAAGAAACTGCTCAACCTCCCGGTCGCCGAGA
CATCACTGGTATCGGCGTTGCACAGCCACTGAATCGCCGATATGCTTATG
GCCGCGTCGAATGTGCCTGGGCGAAAGGGAACGCCTTGTCCGACGTCGGC
GAGGAACAGGTCGCCGGCGGTCTCGCGGTCGAGTGCCACAGCAAGCATAC
TGGCGGATATATCCATCCCGATCCATGTGTGGTTCGATGCGGTCAGGCTT
TCCCCGC

Sequences in the Contig:

SY0AAB60YG14FM1