Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YG09FM1
Length(NT) : 596
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: ankyrin repeat domain protein
Accession: ref|XP_001273619.1| Score: 335 E_value: 6e-30
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 318 E_value: 3e-28
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 251 E_value: 1e-22
PFAM Definition: No Hit Found
Swissprot: P16157|ANK1_HUMAN
Gene Ontology:
GO:0016323 = Cellular component: basolateral plasma membrane
GO:0005856 = Cellular component: cytoskeleton
GO:0008093 = Molecular function: cytoskeletal adaptor activity
GO:0019899 = Molecular function: enzyme binding
GO:0030507 = Molecular function: spectrin binding
GO:0005200 = Molecular function: structural constituent of cytoskeleton
GO:0007010 = Biological process: cytoskeleton organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0045199 = Biological process: maintenance of epithelial cell polarity

Sequence:
>SY0AAB60YG09FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGGCCCATGGAACGCCACTGTGGTATGCTGCTAAGAATGGGCAC
GGGGAAGTGGTGGAAATGTTGCTTGCACGGCAAGATTTCAACCCCGATAA
ACCATCTGAGGGCGGCCAGACACCACTCTGGTGTGCCGCTCGGAACGGGC
ACACGGAAGTGGTGAAAATACTACTCAGACGGGCTGACGTCGACCCCAAC
AAACGAGATGAAGATGGGCTAACGCCACTCAATTGTTCCACCGCGGCTGG
GCAAGGGGGAGTCGTGAAAATACTGCTGGGACGCGGTGATGTCAACCCCA
ACGGACCGAATATCTATTGCAAGACACCACTCCATTCCGCTGCTTCGAGT
GGGCGCGAGGGAGTGGTAAAATTACTACTCGGACGGGCCGGCATCGACCC
CAATAAACCAGATATCTTTGGCTATACACCACTCTGTTGGGCTACTATGA
ATGGCTATGCAAGAGTGGTGGCGCTACTACAGCCCTCACCATCTGCCTCC
CGCAACACAGCCTAATGCCTGGGAGACATTCCCCCTCCTTACCTCG

Sequences in the Contig:

SY0AAB60YG09FM1