Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YF21FM1
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00004484001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: inositol kinase kinase (UvsB)
Accession: ref|XP_746662.2| Score: 560 E_value: 6e-56
KEGG Definition: inositol kinase kinase (UvsB), putative
Accession: afm:AFUA_4G04760 Score: 560 E_value: 3e-56
KOG Definition:
Classification: [Signal transduction mechanisms, Chromatin structure and dynamics, Replication, recombination and repair, Cell cycle control, cell
Kog Number: KOG0890 Score: 571 E_value: 1e-59
PFAM Definition: PI3_PI4_kinase, Phosphatidylinositol 3- and 4-kinase. Some members of this family probably do not have lipid kinase activity and are protein kinases..
Pfam Number: pfam00454 Score: 178 E_value: 3e-14
Swissprot: Q02099|RAD3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0000228 = Cellular component: nuclear chromosome
GO:0005515 = Molecular function: protein binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0000076 = Biological process: DNA replication checkpoint
GO:0031573 = Biological process: intra-S DNA damage checkpoint
GO:0007131 = Biological process: meiotic recombination

Sequence:
>SY0AAB60YF21FM1
TTGGGTCCACTGCCCGAGAAAGGGCCCAACGTGGCTCACTTATCATGACC
CATCTGAAAGACGCTCTGAAAAAAAACCGGGAAGAAAGCGATCTAGACGT
AAGAAGCCTAATCCTCCAGGCGACTAAATTGACAGACCAGCTCTTGCATA
TTTCCAATGTGGAGTTAACGGGCTTGAAGGCTCCCGCAACCATCAGCATT
AAGGAACATGGCTTCAATCATAAATGTGCGCCTTGCGCACTTGTGGTTCC
GACGCAGGTTATGCTTGCGGTTACGCTCCCGTCCGTGCCGGATACTGTGA
AGACGCATTTACCATTTCCGAGCCACCAGCCGACTATTTTGAAGATTGAG
GAGGAGGCCGATGTCATGAATTCCCTGCAGAAACCCAGAAAAATCAAGAT
TCGGGGGACCGACGGAAGGCTTTACGGCTTCTTATGTAAACCGAAGGATG
ACTTGCGTAAAGATGCGCGTTTGATGGAGTTCAATAATATGATCAATAGG
TTCTTGAAGAAGGACCCTGATTCTAGTCGACGCCGGATGTACATCAGAAC
ATACAGCGTCACTCCCCTAAATGAAGAATGCGGACTAATCGAATGGGTGA
ACGGTGTCCGAACATTGCGTGAGATATTACTCACCTACTACAAATCTAAG

Sequences in the Contig:

SY0AAB60YF21FM1