Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YB10FM1
Length(NT) : 491
Best Gene Model Blast : Link to GSTUMT00000462001 E-value : 1e-96
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN7303.2
Accession: ref|XP_680572.1| Score: 153 E_value: 5e-09
KEGG Definition: hypothetical protein
Accession: ani:AN7303.2 Score: 153 E_value: 2e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB60YB10FM1
TTGGTGGAGGTGTCTTAACTGGACAAATGAAACCATGATTGACGAACACG
GCCATACACATTTCGAGCAACCTCAGCCAAGAAAAGCCAGCAAGAAGAAA
GGAAGTGCTCAAGAAAAAGGAGTGCCTCTAAACAGGCAAGGAAAGCCGGT
CAGTAGGCAGGGGGATCGTTATAGTTTCTGAGAGTTGAGCGCATGGGGCA
TTTCCTGCATTAATTGCGATTCTTTTTGTTTAACATTTGGCTCTTACAAG
AATTGTTGGGCTACTGAATTCGATGCGAGTTGTGGTGCTAAATTTTTTCT
TTTTTCTCCTGTCGGCGCAAGGGTTTTTTTTTTCTCCCTCTTTTTTCCCT
CTTTTTTTTTTTTCCTTGCTAAGTTCTTTTTTATATCTCTTCTGTGGGTG
TTTGCATTGCGGTTTTATTCCCCCTAGTGCTGGAATTTATTATATCTTAT
ACCTTTTGTTGTCCTTCCTTCATTTTTCTCCTCTTTTCTTC

Sequences in the Contig:

SY0AAB60YB10FM1