Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB60YA10FM1
Length(NT) : 381
Best Gene Model Blast : Link to GSTUMT00001013001 E-value : 1e-104
Numbers of ESTs : 1

Blast Results:

Nr Definition: Glutamine synthetase (Glutamate--ammonia ligase) (GS) gb|AAP23163.1|AF462037_1 glutamine synthetase
Accession: sp|Q86ZU6|GLNA_TUBBO Score: 335 E_value: 3e-30
KEGG Definition: hypothetical protein
Accession: ang:An01g08800 Score: 285 E_value: 1e-24
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0683 Score: 239 E_value: 1e-21
PFAM Definition: Gln-synt_C, Glutamine synthetase, catalytic domain..
Pfam Number: pfam00120 Score: 145 E_value: 8e-11
Swissprot: Q86ZU6|GLNA_TUBBO

Sequence:
>SY0AAB60YA10FM1
TTGGCGGAAATATTGATGCCTTTTCCGGTTTCATGTCTACCGGTGAGACG
GAGGGTGTTGTCATCGCCATAGACGGCGATGTGCTCCGCGTGGCGAGTCG
AGAGCTTCTGAATGGCCTCCTCAATAGCCTTCATGCCTCCCTCATCGCGC
ATAGCCTCGGTAGACATGAAACCGGAAATATTGATGCCTTTTCCTATGGT
GTCGCGGACAGGGGGTCTTCTATTAGAATCCCTAGGTCTTGCGCAAAGGA
AGGCAAGGGTTACTTTGAGGATCGACGTCCTGCATCTAATGCTTGTCCAT
ACCAGATTACTGGTATCATGATGGAGACTATTTGTGGCGGCATTTAGATT
ACGGGTTTTCTTTACTGGCGCAGTTAATGTC

Sequences in the Contig:

SY0AAB60YA10FM1