Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YO02FM1
Length(NT) : 596
Best Gene Model Blast : Link to GSTUMT00011533001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 274 E_value: 7e-23
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 265 E_value: 4e-22
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 187 E_value: 2e-15
PFAM Definition: No Hit Found
Swissprot: Q71S21|INVSB_XENLA

Sequence:
>SY0AAB5YO02FM1
TTGGGCACGGAATGATGTTAATCCCAACACCGTTGACTCCACATTTGGCC
AAACGCCGCTCTCGTGGGCCGCCCAGAGCGGGCATGAGGGGGCCGTGAGG
ATACTGCTGGAACGGAACGACCTTAATCCCAACAAAGCAGATAAGTGGGG
CCGAACACCGCTCTCGCGCGCCGCCGAGAATGGGCATGAGGGGGTGGTGA
GAATACTGCTTGAACGGAACGACCTTAATCCCGACAAAGCGGATAAGCGT
GGCCGAACACCGCTCACGTGGGCTGCTCTTCGAGGGCGTGAAGGGGTTGT
GAGGATACTGCAGGAACAGGCGGATTTGATTCCTAGATAGGCAGATAAGC
AGCAAGCCCACAATTAACATATCCCTTCCTCGCTGAGCTTTCTGTGCCAT
CCGTATCCTTTTCCAAAGAGGTCTGCAGGCCTCGATACCCATGGATAAAA
CCTGATACTCCTCCTTCACTCCCCCCTCCCCCCCGCAGACGTGCCCTCCC
AGTAAGGGAACAAACTTGACCAAACACAATCCTAAGCCCGCCTCAGGCAA
TCCTTTATATGCGGGTTACCAAGTTACGACTAGTGTCAATCCTTCA

Sequences in the Contig:

SY0AAB5YO02FM1