Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YL05FM1
Length(NT) : 672
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 264 E_value: 2e-43
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 219 E_value: 2e-35
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 196 E_value: 3e-16
PFAM Definition: No Hit Found
Swissprot: Q8UVC3|INVS_CHICK

Sequence:
>SY0AAB5YL05FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGAATAATCAAACACCGCTC
GGGTGTGCCGCTATCGGGGGGCATGAAGGAGTGGTCAAGCTGCTACTAGA
ACGGGAAGATGTCGACCCTAATCACCAAGATAAATATGTGGAAACGCCAC
TAGGGTGGGCTGCTATTGGGGGGCACGAAGGAGTGGTGAAAATGCTGCTA
GGGCGAGAAGATGTCGACCCCGACACGCCAGGTTGCCAAAACGGTACACC
ACTCTTTTGGGCCGCTGATGGCGGATATGAGGGGATTGTGGGGCTGCTAC
TAGACCGCAAAGATGTTGACCCCAATCGCCCACATGAGAGTAATCAAACT
CCACTCGTGGTGTGCCGCTGCCAATGGACATGAAGGATTGATCAAGCTAC
TATTAGAACGGGATGGTGTCGACCCCAATCGCCCAGGCAGGAATGATCGA
ACACCACTCGGATGGGCGGCTGCCGATGGGCACGAAGGAGTGGTCAAACA
GCTATTAGAACATGAAAGTGTGGACCCCAATCGCCTTGATGAGAAGGATC
AAACTCCACTCGCATGTGCCGCTCTCGGTGGACATGAAGGAGTGGTCAGG
CTGCTGTTAGAACGGGAACGTGTCGACCCTAATCGCCCCGACTTGAATGG
CCGATCACCACTCGGGTGTGCT

Sequences in the Contig:

SY0AAB5YL05FM1