Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YK18FM1
Length(NT) : 631
Best Gene Model Blast : Link to GSTUMT00010398001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_00047
Accession: ref|XP_001560962.1| Score: 788 E_value: 2e-82
KEGG Definition: PHOSPHATE-REPRESSIBLE PHOSPHATE PERMEASE
Accession: ncr:NCU09564.1 Score: 704 E_value: 6e-73
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2493 Score: 574 E_value: 4e-60
PFAM Definition: PHO4, Phosphate transporter family. This family includes PHO-4 from Neurospora crassa which is a is a Na(+)-phosphate symporter. This family also contains the leukaemia virus receptor..
Pfam Number: pfam01384 Score: 510 E_value: 1e-52
Swissprot: P15710|PHO4_NEUCR

Sequence:
>SY0AAB5YK18FM1
TTGGAGCGTGCAGATGCGGGCCCCTGGTACGCTCCCAAGAACCTTTGGAA
GATCATGGTTGATGCCGCCCTCCACGGTGTCCGTGTCGACGTCATCTCCG
AGCAGGGCCGCAATTCGAAACTTACCGGGAACATCAACGACATGCATGCC
CGTGCCACGCGATTCGACAATAAGACTGAGCACCTCTACTCCTTCCTCCA
GATTCTCACTGCTGCCACCGCATCCTTCGCTCACGGTGCTAACGACGTTG
CCAATGCTACCGGTCCCCTCGCTACAATCTACCTCGTCTGGAACACAGGT
GTCGCCAACAAGAAGGCTCACGTCCCGATTTGGGTTCTTGCCTATGGTGG
TGCTGCTATCGTCATTGGTTTGTGGACTTACGGATACAACATCATGCGCA
ATCTCGGTAATCGCTTGACTCTGCAATCCCCTTCGCGTGGTTTCTCTATG
GAGTTGGGTTCCGCCGTTACCGTTGTCCTTGCTACTCGTCTTGCCCTGCC
GATTTCCACAACTCAGTGTATCGTCGGCGCAACTATGGGTGTCGCGCTCT
GCAATGGTGACTTTAAGGCGCTTAACTGGAGGATGGTTGCCTGGTGTTAT
GCCGGTTGGGTCCTTACCCTCCCTATCGCCG

Sequences in the Contig:

SY0AAB5YK18FM1