Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YK13FM1
Length(NT) : 598
Best Gene Model Blast : Link to GSTUMT00008725001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein Kpol_513p8
Accession: ref|XP_001644350.1| Score: 368 E_value: 9e-34
KEGG Definition: hypothetical protein
Accession: yli:YALI0A17919g Score: 363 E_value: 2e-33
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P38288|TOS1_YEAST
Gene Ontology:
GO:0009277 = Cellular component: fungal-type cell wall
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0042493 = Biological process: response to drug

Sequence:
>SY0AAB5YK13FM1
TTGGGCCGGTTCCTCTAAGCCGGAGATTTTGGGTGATATCACCACCGTCT
CAGATGATGAGTTCATAATCTTCTCGGATAAGAAGTGTGAAGGAGATGAG
TGTGGCTTCTACAGGCCCGGAATCCCAGCCTATCGTGGTTTTGGGGGAGA
CATTAGAGTTGTCCTTGCCGAGTTCTCAATGCCCCGTGACAAGGGTGATG
CTGGTGGAAAGGGTGGTCATGATCTCCCGGCCATCTGGGCTTTGAATGCT
CAGATCCCCCGAGTTGCCCAATATGGGATCAAGAGTGGTTCCTGCTCTTG
CTGGCCGGATTGTGGCGAGTTTGATATCTTCGAGGCTCTTCCTGGTAATC
CCGCCGCTGGACAGTCCGCCGCCGATATGATGAAATCCCATCTCCACTGC
GCGCAGGGTGGAAAATTCGGTGGTGGTGGCAACGTCGACTTCTTTGAACG
CCCTCTCAACGAGCCAATAAAGCTTGCTGCTATCTTTTACGGCGAGAACG
TCTACATCACTAAGCTTCCCAAGGATACCACCTTTGATAAGACATTGAGC
GAGGAGCTCATTGCTAATGCCAAGGACACTAAGTCCATGTTCAAGATC

Sequences in the Contig:

SY0AAB5YK13FM1