Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YK11FM1
Length(NT) : 621
Best Gene Model Blast : Link to GSTUMT00010884001 E-value : 1e-130
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001218681.1| Score: 255 E_value: 7e-22
KEGG Definition: hypothetical protein
Accession: ang:An11g00410 Score: 246 E_value: 4e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB5YK11FM1
TTGGGACACAATCATCCCCGCACCCTTAGGTTTATCCATCCCCAGGCATA
ACTAGCCCAAGCCATCGTCATTGTTTCGTCTGGCTTCACCCGAAAGAAAA
TCCAATCATCACCACAGGCTTTGTTAACCCAGATTCATATTTCATCATGG
CTGAGATTCCCTTTAGCCCGCCTACTGTTCTGAATATCGTAAAGGCGAGC
TTTCCGCAAGGTCCTGGGACGGTACCTTCTCTGAAATCACCCTATGATGC
TGTTGCGATATTCGTCCACGCGTGGTATGCTGTCAGTGGGGTTTCGACTG
GTGGGGTTGGGTGAGGATGACAGCCTGGGTACTGTTGGACTGCTCAATTA
TTACTATCCTCTTACAGTCATCTAATAATCTATTATAGAAACACCCATCG
AGGGCTCGGATCCAAAACCACTTCCACAAAGCTGGAACAGCTCTCCTGGT
AGCTACGGCTTCCGATATGCGCACTCACAATCGTCTTTACAATACCTGAT
AAAGGTGAACCGTCTAGGGAACAAAGCTGTAGTAATGGGTTTGGGAATCG
GCGACGATAAGACTACCTCTTTCGACATTGTCGTAAAGGACTTTCTTAGC
GAGAGCTTCTACCCGTACTCC

Sequences in the Contig:

SY0AAB5YK11FM1