Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YJ14FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00002961001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_13858
Accession: ref|XP_001585289.1| Score: 335 E_value: 5e-30
KEGG Definition: 3'-5' exonuclease
Accession: aor:AO090001000667 Score: 331 E_value: 8e-30
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2249 Score: 318 E_value: 1e-30
PFAM Definition: Exonuc_X-T, Exonuclease. This family includes a variety of exonuclease proteins, such as ribonuclease T and the epsilon subunit of DNA polymerase III..
Pfam Number: pfam00929 Score: 130 E_value: 1e-08
Swissprot: Q6CMT3|REXO4_KLULA

Sequence:
>SY0AAB5YJ14FM1
TGAAGACGTACAAAAAGAAGTATCGGCCATTCTTGCGGATAGGGTTCTTG
TCGGGCATGCGGTCAAGTATGATCTTGAGGCGTTACTGTTGAGCCATCCG
AGGAGGGACATCCGGGATACTAGTCGACATCCCGGATTCAGGAAGTTTAG
TGCTGGACGTACGCCCAGATTGAAGAAGCTTGCCCTCGAAGTGCTGGGGA
TTGAGATTCAGGGCGGGGAGCATTCTAGTGTCGAGGACGCACGAGCTTGC
ATGCTACTATACAGAAAATTCCGCGATGAGATTGAAAAATTGCATAAACC
AAAGGCGCCAAAGGGTGCATCTGCCAAGTCAGGTGGGGGGAATGGGAAAA
GGAAAAGGAAAAGGAAGGCTTAAGTATTATTTATATAATGGGCTTACCCA
ATGCCTTTCTGCCTTCTCGCCTGCTTGTATTAATACTGGGATTTTAACCA
GTCGGTTCGCCCACAGTAGTAGTTTCTGCGCAACTATATGGTTCATAGCA
ATCTCAAATTCCATCATTAGACTTTTCTTTTCTTTTCTTTTCTTTTCTT

Sequences in the Contig:

SY0AAB5YJ14FM1