Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YI03FM1
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00001829001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001269453.1| Score: 658 E_value: 3e-67
KEGG Definition: hypothetical protein
Accession: ang:An07g09710 Score: 647 E_value: 3e-66
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB5YI03FM1
TTGGGTTTCTGGATAAGTTCCGTCCATATCACAAGTGTTTGGCGTTAAGA
TACGTCATTGTTGGGATGAAGCAAAATCATACGCTCCAGTTGTGGGATCT
TGCGCTCGGGAGACCGGTTCAGGAGATTAACTTTCCACAAGAGAGCGATA
CTGACGCATTGTGTTCGGTTGCCTATCACCCGACTACTGGCATTATCGTT
GTCGGAAACCCTACCAGGAATTCAATCTACTTTATCCATCTCTCAGCACC
CAAGTACAACCTTCCGCCCATGTCCCAGGCGCAATACATACGGGGACTTG
CTGTTAAGGATAGCAGTATTCCTAAGCCAGATGCAACTGCTATCCTCAGC
GGTCTCAGAGAGTACTCGTTTGCTTCTAAGGGTCAATTGATGAGCTTGGA
TATCCTTGATGGTGACGCCCAGGGAAGTCTTCCACCATTGTTTGAGCTCT
ACGTGGCGCATAGCAAAGGGATGACCGCCTTGAATGTTTTCAAAGAGGAC
TTGGGTTGGGATGGTAAAAATAGCGCCCAGAACCCAGTCGATGCTGTTAA
AGAAGGTATATGTACACTTTCAGCGATGTCGCCACCACCTCCCCCAGAGA
AGGACAGGGATAGCGATAATAGCAACAGGAGCGAGAAGAGCTCCAAGTGT
GAGAAGGGTATTGAA

Sequences in the Contig:

SY0AAB5YI03FM1