Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YC24FM1
Length(NT) : 703
Best Gene Model Blast : Link to GSTUMT00002596001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05548
Accession: ref|XP_001555873.1| Score: 391 E_value: 3e-36
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 321 E_value: 2e-28
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0510 Score: 290 E_value: 5e-27
PFAM Definition: No Hit Found
Swissprot: P57078|RIPK4_HUMAN

Sequence:
>SY0AAB5YC24FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGTAGCCGTGGTCGGACACCA
CTCTATCTTGCAGCATCAGAAGGTCGCGAAGAAGTGGTCAAGCTCTTCCT
CCAGGAGAAGCGAGTCATTCCGGATGCCGGTGTCCCGGCTGCCATACCTA
CCCACGCCGCGGCATGGCGTGGGCAGGATGAGGTAATGCGCATCCTACTC
GCGAGCGATCGAGCAGGCATCGCACTGGAAGACCCGGCTCGGAGGACCCC
ACTACACGTTGCCGCCATCCAAGGCAACGAAACACTCACTAGAATATTAC
TAGCCGACAAACGTATCGATCCTAATCTCCGAGGCGACGATGATGGTGGC
ACACCGCTGAACTTGGCGACCACAAATGGCAACGAAGGGGTAGTCCGAAT
CCTCCTGGCAGATCCCCGGGTCGACTTGAACCTCGAGAGCTACGAAGGCT
GGACACCCCTGCACATGGCCGCGTGGGGCAACCACGAAAACATTGCCCGA
TTACTTCTCTTAGACCCCCGAGTGAAGGTGAACCAGACGGACCACGACGG
TGGCACACCACTCCACCTCGCCGCGATTAAAGGGCACGAATCAATTGTTC
GCTTACTCCTAGCAGACAAACGCATAGTCCCAAGTCTGGAAGATCACGAC
GATAAAACCCCCCTCCACCTTGCAGCCTGGAACGAGCGAGACGAAGTCGT
GCG

Sequences in the Contig:

SY0AAB5YC24FM1