Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB5YC02FM1
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00000712001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG08880.1
Accession: ref|XP_389056.1| Score: 342 E_value: 1e-30
KEGG Definition: hypothetical protein
Accession: fgr:FG08880.1 Score: 342 E_value: 7e-31
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1770 Score: 360 E_value: 3e-35
PFAM Definition: SUI1, Translation initiation factor SUI1..
Pfam Number: pfam01253 Score: 243 E_value: 1e-21
Swissprot: P79060|SUI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB5YC02FM1
TTGGCCTTCGCATTCCCGTCCAACACACAAGCTATCACCGGCACAACACT
ACTACATTTCAAGTCCAAACCACTGCTCCGAAGCACCCAGAAACAGCTTT
CCCGCATACCCAACCCCCCTCGAAGTCTGTTTATGTCCATCGAAAATCTC
AAGGTTAATGATCCTTTCGCCGACGACGTTGGTGATACTCAGCCCAAGAA
TTACGTCCATATTCGTATCCAACAGCGCAACGGTCGCAAGACCTTGACGA
CTGTCCAGGGGTTGTCTAAAGAATACAGTCCTAAAGCTCTTTTGAAAGCT
TTCAAAAAGGAATATGCTTGCAATGGCACTATTATCCAGGATAAGGACAT
GGGAGAGGTGATCCAGCTTCAAGGCGATCATCGTACAAAGGTTATGGACT
TCCTTACCGATAAAGGAAGCGACAAGATGGGCAAGTACGCACTTGCCAAA
GAGAATATCAAGGTGAGCCATTTTCTTCGGAAATAATTTCCGGCAATTCG
GTTGGAGGCTCTGCTCACATGATATTTAGATCCACGGGTTTTAAGCCCTG
CGTCTCCAGCCTTCCTCAACACCGTTTACGTTGGTATTTGAGGAATGCTT
TGCGCTGGAAGACATGTGGGGTTTATTACAGTGTGCATGCTTGAGATTTC
GGGGGTTTGCAGTATACATACTTAATAAAACGTTAC

Sequences in the Contig:

SY0AAB5YC02FM1