Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YP09FM1
Length(NT) : 410
Best Gene Model Blast : Link to GSTUMT00001399001 E-value : 2e-60
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2925 Score: 148 E_value: 5e-11
PFAM Definition: No Hit Found

Sequence:
>SY0AAB59YP09FM1
TTGGGGAGCTCCTCGTGGAGTTGCCAAAGACGTACCGCAGCGTGGTGTGG
GTTCGTAGGAACCGGTTCGTCCTGGTTGATACGGAGGGGTTTGATGGCGG
GGAAGGGGGGAAGGTTGGGGGGAAGGTTAAGGTTGTGGTTAGGGGGGAGA
AGGGGTGGATGGGGATGGGGTATTGGCCAAAGCATTTTACTACCGGGTAC
GAAGGCGAGGACGAGATGTCTGAGGGGCAGGAGGAATCAGCCGCTGGGAA
GATGCCGCCGGGTTCAGATGATGAGGAGTCAAAGTGATAAATACCTATGA
TACAGGCTGATTTCTTTCCTCCCCTTTCTTCTTGTCGGTTTTCAAAAGTT
TGTTTATTTGATCATTCCCATATACGATACAGTACAATTCCATCTAATAA
GTTTCAGTAC

Sequences in the Contig:

SY0AAB59YP09FM1