Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YO20FM1
Length(NT) : 446
Best Gene Model Blast : Link to GSTUMT00007270001 E-value : 1e-135
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543717.1| Score: 96 E_value: 3e-07
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB59YO20FM1
TTGGCATTGACAGACCAAGATAGCCAAACATGCCGTCTGCTGATCGTTCC
GAATGGCGCAATACTTTCATTTACGCTTCCAACAATCGTGATACCGTGCT
CGGAGGCCTCTGGGCCACCCCGGGTATTACAAACCGCAATCTCTATGCCA
TGCTAGATATTTTTTGTTTGTTTAGCAACCCTTTCGAGCTACACGACGAG
GACGGACGGTTAGTTGAAATGGATGAGGCACAGCTTCAACCGGGCAATTA
CTATATTGTTACTCAGGGTGGCCTTCTTCTGTGCTTTCCATCTTTAGCCG
CTACTCACTGTGAATAGGTGACGTTATTCTCACTGATGAGGCACCGCTAC
TTCGTACGATTTCGTTGCAGTCCGGAACCCGTGTTGCTGCGTTCCGTGAT
GAAGTACGTGCACGAGACGGACGCTGCCTTTTCACCGGCCACCGAT

Sequences in the Contig:

SY0AAB59YO20FM1