Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YO10FM1
Length(NT) : 576
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: YfhO, Bacterial membrane protein YfhO. This protein is a conserved membrane protein. The yfhO gene is transcribed in Difco sporulation medium and the transcription is affected by the YvrGHb two-component system. Some members of this family have been annotated as glycosyl transferases of the PMT family..
Pfam Number: pfam09586 Score: 105 E_value: 9e-06

Sequence:
>SY0AAB59YO10FM1
TTGGCTTTTCTAATCCCCACACTCTTTTTTTTTTTATATATCTTTTTATA
ATATACATATATTTTTTTTTAAACATTTCTGCTTCCCACCTCTTCAGACA
CTCTCTTTTTATTCTACTCGCTGGAAAGCCCCCCCCGTCTATTCTTTGCT
TTCCATTCTAGCTTTCATTTCAACTATTTTGCGATATACAGCTTTTATTT
ATTTATGCCTGCAACAGTCTGTCCTTTCCCGACTCACTAATTCGTTTATT
CGTTTTTTATACATTTTTTCGGCTTCTTCAATCACCGTTGCGCATAACAC
ATCACACGGTCACTTTGCCATCGCTTTGATATTGCTGGTATTCCTGTTGC
CTGGTTGGCCACCCGATACTCGTAGAACGATTTAGGATTTTCCATCTATA
CAGATCCAATCAGTGCCTCTTGCTCGGGAATACCTTATTTTCTCGTTTAT
CCTATATTTGCTTTCCCCACGGTCTGTGACGAATCGGCTTCGCTCTGTTC
TCTGGTTCTTTCGCTTATCGATCGCTGTCTTCAATCCCCCCCCATGTTTT
GTTGTTGAAAGAGGTTGGGTGAAACT

Sequences in the Contig:

SY0AAB59YO10FM1