Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YN20FM1
Length(NT) : 467
Best Gene Model Blast : Link to GSTUMT00010754001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1676 Score: 131 E_value: 6e-09
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 133 E_value: 3e-09

Sequence:
>SY0AAB59YN20FM1
TTGGATCCCTCGCAACAACAATCGCAACAGTGGCAGCAACCTTATACTTA
CAACGCCCACCAACAATGGCCGCAACCCTCGACCCAAACACAGCCACACT
ATACTCCACATGCGACTGCTGCCTCTCCAACTGCAGCGTATGGACCTCAC
CAACCGGCAGCATATCAGGGTTACAGTCAACCATCTGCCCATCAATCGCA
TCCACAACCTCAACAACCACGTACCCGGCAACCATACTATAACTATCTTC
AGGGAGCCCATGCACCCCCTGTCCATCCACCGACCTCATTTAACCCTCAG
TTCCATCGTCCTCAGCACCAATTCAGACAAAGGCAGAATAACAAACACCG
GTCTCAACACCATACACCGTCATTCCAGCAGCAACCGCAACGCAATGCAT
CGCCTGCTCAAGTTGCTCCCGGTCCATCTCAGACGGCCTCACAAGCAACT
GCTAACAATCGCCGTGA

Sequences in the Contig:

SY0AAB59YN20FM1