Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YN11FM1
Length(NT) : 402
Best Gene Model Blast : Link to GSTUMT00001912001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_09131
Accession: ref|XP_001590366.1| Score: 259 E_value: 2e-21
KEGG Definition: hypothetical protein
Accession: mgr:MGG_08084 Score: 231 E_value: 2e-18
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P24276|SSD1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0003723 = Molecular function: RNA binding
GO:0007047 = Biological process: cell wall organization and biogenesis
GO:0001302 = Biological process: replicative cell aging
GO:0042493 = Biological process: response to drug

Sequence:
>SY0AAB59YN11FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCTGCGACCAGCTTCCATTGAAGAAGGCAGAATTTGATAAAACT
AATCGTGTGTTGGAATTATATTGGGAGAAGGGCGTTCAATCCAATGTGTA
CATTCCGGAAGATGAGCGCCCCAAGGGTGGGGCTGCCCTTCGTGCTGCTA
ATGCCGCCGCTGCTGCCAGTCAAGCCGCGGCTGCAGCGAAGGCTGCCCAG
GAACAAGAGGAGATACAGCGCAAGATGATGGAAGTTTCATCGCGAAACCC
CGATGCTGAACAGGGTTTGTTTGACGACAAAAATGATTCAAATCCCTCTG
ACGGGGGCGTTGCTACTGAGAGACCGACTACTCTTGCTCCGGTTGCCGCT
AG

Sequences in the Contig:

SY0AAB59YN11FM1