Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YN04FM1
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00001321001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGG_13816
Accession: ref|XP_001404311.1| Score: 159 E_value: 2e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG09861.1 Score: 159 E_value: 8e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB59YN04FM1
TTGGAGCGACGAACCTAGATACTATATCAGATACCCACTGATGATTTAAT
CCCCATATCACGGATCCTATCTTCCCACTTTTGATACCGGTATTTGCGGT
GTGGATAGCGCTAGGGAACGCGTACTGTACAATCCGCCCCACCTTCCGTC
ATTTACCCAACCACAGCTGCACTTTCCACCCTCGATTCCAAACCCAAATG
GCACCCTCAGGAATCTGCATATCCTGCCACGAGGCGCTCACAATCCCAGA
CGAAGACCACCCTCTGGAACCCGGCCTCGTCGGCGACGTAGAATTACGCT
GCGGGCATCATTATCACTGGTCCTGCTTCGCAGAGGAATACTCCGCCGAT
GGCGCCACCCCCGCGACCAAAGCGCAGTGCCCAACTTGCACGCATGACAT
AACCACGAATGGAAAACTCCTAGTCACGCTACGGAACGAAGGTGGCGAGC
AGCCAGACACCGATATCGGAACGCTGCTCGAGGAAGAAGAGTTTTATGGT
CGGAATCCGGAGATGAAGGAGGTTAGGGCTTTTCTCGAGTTTTGCGCTGA
AGGTGACGAGGGTGAGGTTCGGGAAATGCTCGCGGCGAC

Sequences in the Contig:

SY0AAB59YN04FM1