Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YM24FM1
Length(NT) : 573
Best Gene Model Blast : Link to GSTUMT00005864001 E-value : 1e-129
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_503964.1| Score: 219 E_value: 2e-16
KEGG Definition: hypothetical protein
Accession: yli:YALI0E15037g Score: 219 E_value: 8e-17
KOG Definition:
Classification: [Transcription].
Kog Number: KOG1510 Score: 277 E_value: 9e-26
PFAM Definition: CSE2, RNA polymerase II transcription mediator. These proteins include CSE2 and a subunit of the Mediator complex..
Pfam Number: pfam07544 Score: 170 E_value: 3e-13
Swissprot: Q6C5U8|MED21_YARLI

Sequence:
>SY0AAB59YM24FM1
TTGGGCCTACATACCTGTCCTCCCAATAGACAAGCATCCGCCATATACCA
GCCGCAAACCATCAATCACGGTAATACTTTAGCAAAATACAATGGCAGAT
AGACTATCCCAGCTTCAAGACGCTATCGACCAGATGGCAACCCAATTCTT
CAGCGCCCTCCGCTACATCGGTACCCACCACGACGCAGTACCCGTCGGAA
ACGAAGCAAAAGTCACCGACGATACCGCTGTCATCGACGACAAAACCACA
TTTGACGCCGCAAAGGTCGAACTCGCCCGTGATTTGATATTCAAATCCAA
GCAGATCGAGTTCCTGATCACCTCTTTACCGGGAATCGGCGTTTCCGAGG
ACGAGCAGCAGGAGCGGTTGAAGAGTTTGGAGACCGAGTTGAAGGAGGCG
GAGGAGGAGAGGTGCAGGGCTGTGCAGGAAAGGGAGGCGGCGGCGGAGAA
GTTGGACGCAGTTATTCGGAGGTTGAGAAGGTTTTAAATTGTTTAGGGAG
GAGAGCTAGAAGTGACTTTCTTTTATCTCGAATGTTGTACTGTGGGCGTA
TCGAGACTCGCAACGTGCTTGGG

Sequences in the Contig:

SY0AAB59YM24FM1