Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YL23FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00003796001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved fungal protein
Accession: ref|NP_596051.1| Score: 209 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: spo:SPBC29A10.06c Score: 209 E_value: 9e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O94384|YGS6_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAB59YL23FM1
TTGGCTCCTTTGTGAATTCATTGATCCCCACAGAATTCTCAACTCCCATA
ATCCAGAGGCTCTATCATGGATCTTGACCGAAGCTCCCTTGCTATTTACC
GCTCCATCTTTCCCGACGATAGGAAATTCCCATATACCAGGGATCGTACT
GGTCAAATTATGCGGCATCGGAGTTCGCTTGACGGGTGTCTGTTCTTTGA
TTATGTTCTCAGGGAGATAGCTCGTATCGAGGATGTTGACCGACTTTACC
CACCAAAGAACGTTGTCGCCTTACGAACACTTGTCACCGTCATCATGGAG
AAGGAAGAATTAGATAAACTGAAGAGAGACTCTTTCATATACTACCTCAA
AAAGGATTTCGATCACGCACACCCTGACAATGATGACGCTGGAAGCTACG
CTCAGAAGGCTCTGGTTCAGCCAAACTTTTGTAGTCTGATGGATGGTCTC
TGGGCTTTGGATAATTTCCGGTTCGAGGAAGCTATTATGCGCTTGGCTGA
GCCTGCCCGTTACGCCCATCA

Sequences in the Contig:

SY0AAB59YL23FM1