Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YL17FM1
Length(NT) : 453
Best Gene Model Blast : Link to GSTUMT00003821001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_07745
Accession: ref|XP_001225401.1| Score: 503 E_value: 1e-49
KEGG Definition: hypothetical protein
Accession: ang:An02g10780 Score: 501 E_value: 9e-50
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4198 Score: 281 E_value: 2e-26
PFAM Definition: zf-RanBP, Zn-finger in Ran binding protein and others..
Pfam Number: pfam00641 Score: 115 E_value: 3e-07
Swissprot: O13801|YE04_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>SY0AAB59YL17FM1
TTGGAAACAGACCTAGGCCTGGGGACTGGACTTGCCCATCTTGTGGATTT
TCCAACTTCCAGCGTAGAACTGCTTGTTTCCGATGTTCATTCCCTGCTGT
TCCCGCCGGACCAAGCCCGGATACCGTGTTTGGCTATTCCGGCTACTCCC
AGAGCATGGTTCCGCCTCAACCTCCGGCTATGGGGCATGGGGCAGGACAT
GGACTGCAATCTAGGGCTATGCCGGGCGGTGGGGCGGTGCCTTTTAGAGC
GGGGGACTGGAAGTGCGGTTCTGATGGGTGTGGTTACCACAACTTTGCCA
AGAATGTTAGCTGCTTGAGGTGTGGTGCAAGTCGTGCTGGTGCGGCAGTT
GCCGACACGGCATTTCCATCGCCTATGGATGGGCCTCCGTCTTATGGAGC
ATTTGGATTGGGACCAGGACAGATTCTTGGGGGTGGGGCGGGACCCGTTG
GAG

Sequences in the Contig:

SY0AAB59YL17FM1