Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YK10FM1
Length(NT) : 626
Best Gene Model Blast : Link to GSTUMT00009744001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10836
Accession: ref|XP_001550363.1| Score: 516 E_value: 7e-51
KEGG Definition: hypothetical protein
Accession: ncr:NCU08341.1 Score: 491 E_value: 3e-48
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0207 Score: 286 E_value: 1e-26
PFAM Definition: No Hit Found
Swissprot: O59666|ATU2_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0005774 = Cellular component: vacuolar membrane
GO:0005524 = Molecular function: ATP binding

Sequence:
>SY0AAB59YK10FM1
TTGGGTTTCGAGGATGTTGCTGGGATTGGAAGCTTTACGGTCAGCTTAAT
AACGGAGAGGGCAGTGGCGGTTCACGATCCGAATGTTATTTCGGCTGAAA
AGATTGCAGAAATAATCGACGACCGAGGATTCGATGCAAAAATCATATCA
ACAGACCTTCTGGGCAACGATGATCAGGGTGCAAAAGAAGATACCATAAT
ATTCAAGGTTTTCGGCGTGAACTCAGAGGAGGATGCCATAAGGCTAGAGA
ACTCTTTTCGCACCTGTGAAGGGGTTATCGATGCAGTTGTGACATTACCT
GATGCAAGGGCTGTAATCGAATACTATCCGTCGAAAACTGGAGTGCGCAA
CCTTGTCGATATAGCCGAGTCATTAAACATGAACGTCCTCCTAGCGGATA
TGGAAGACAATAGCGCTCAGCTAGAATCCCTGGCGAAAACGAAGGAAATC
AAACAATGGCAGCACGCGTTCTGGTTTTCGCTGTATTTTGCCGTTCCCGT
GTTTTTGATATCCATGATAATTCCTATGTGGTTTAAGGGACTCGATAAGT
ACATCGGCCAGCTCTGTATAATACCGGGACTGTATCTGGGCGATGTCATT
TGTTTGCTGTTAACCATTCCGGTGCA

Sequences in the Contig:

SY0AAB59YK10FM1