Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YK08FM1
Length(NT) : 285
Best Gene Model Blast : Link to GSTUMT00002844001 E-value : 2e-10
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB59YK08FM1
TTGGGTGGTGGGAGCCTCCGTGCTTGGAGTTTAGGAAAGGTTATATGTTA
TTCCACATGTCTTCGGCGTTTTTGTTATACGAAAAAGTTCCTTGCTTTTT
TTTTTTTTTTTTTTTTGCTGGTTTGGTTTGGTAAGATTGACTGATTTACA
CGTATAAAGATGGATGGATATCAAGAGTTGTGGAGAAAGGTGGGAGGTGT
AGTGGTTTCTCCAAAAAGTACAGTAAATAGAGTGCTAATCGATCGATTGT
ATTGTATTATATTGTGGTTCAATATGTTTCTTCCT

Sequences in the Contig:

SY0AAB59YK08FM1