Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YJ14FM1
Length(NT) : 571
Best Gene Model Blast : Link to GSTUMT00004387001 E-value : 1e-149
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543815.1| Score: 192 E_value: 7e-27
KEGG Definition: quinone oxidoreductase, putative [EC:1.6.5.5]; K00344 NADPH2:quinone reductase
Accession: afm:AFUA_5G11430 Score: 177 E_value: 4e-24
KOG Definition:
Classification: [Energy production and conversion, General function prediction only].
Kog Number: KOG1197 Score: 238 E_value: 4e-21
PFAM Definition: ADH_N, Alcohol dehydrogenase GroES-like domain. This is the catalytic domain of alcohol dehydrogenases. Many of them contain an inserted zinc binding domain. This domain has a GroES-like structure..
Pfam Number: pfam08240 Score: 124 E_value: 5e-08
Swissprot: P38230|QOR_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0017091 = Molecular function: AU-rich element binding
GO:0003960 = Molecular function: NADPH:quinone reductase activity
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>SY0AAB59YJ14FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGACGCCATTTCCTAGCAGCC
TTTCGCATTTCAACTACGAAATGTCTTCACTTCCGAAAACCCAGCGGTCG
GTTCGAATTAATGCTCATGGGGGACCAGATGTGATCGAGATTGTTACAGA
TGCACCCGTGCCGACCCCTACGGATAATGAAGTTTTGGTCAAGAATACGT
ATGCTGGGTTGAATTTTATCGATATTGTTTGTCCTTTTCTCCTTGTTCTC
GCCTTTACTCCAAGGGGTGTGGTGTGGTGATGCCACAAACTGACCAATGG
GGCAGTACTTCCGCAAGGGTGTCTATCCGACATCTTCGTTCCCGCTTACC
CTTGGACGAGAAGCGGAGGGTACAATCGCTGCAGTTGGAAAGTCCGTTCA
GAACTTCGAGGTTGGCGACAAGGTAGCGTACTTAGGAGTTGGCGCACAGC
AAGAATATACCGCTCTCGATCCGCTCCATGTCGCGCATGTTCCCTCTGGT
ATCCCGGAAGGCGTTGCGGCAGCCGGTATTCTTCAAGGTATCACCGCTCT
GACGTTCGCCCGTGAGAGCTA

Sequences in the Contig:

SY0AAB59YJ14FM1