Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YH09FM1
Length(NT) : 523
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 334 E_value: 6e-30
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 309 E_value: 2e-27
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 234 E_value: 8e-21
PFAM Definition: No Hit Found
Swissprot: Q80YE7|DAPK1_MOUSE
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005524 = Molecular function: ATP binding
GO:0005516 = Molecular function: calmodulin binding
GO:0006916 = Biological process: anti-apoptosis
GO:0008624 = Biological process: induction of apoptosis by extracellular signals
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0007243 = Biological process: protein kinase cascade

Sequence:
>SY0AAB59YH09FM1
TTGGAGATGTTAGCCACGATACGCCAGACAATGATGGCCGAACACCGTTC
TTGTGGGCTGTGCGGTGCGGGCGTCATAGAGTAGTAAAGCTACTATTGGA
AAGAGAAGATGTTAGACCCGATATGCCAGACAAAGATGGCCGAACACCAC
TCTTCTGGGCTGCACGGTACGGGCGCGAAGGAGTAGTGAAGCTACTATTG
GAACGAGAAGATGTTAGACCCGATATGCCAGACAAAGATGGCCGAACACC
GCTCTTCTGGGCTGCACGGTACGGGCGTGATGGAGTAGTGAAACTGCTGT
TGGAGCGGGAAGATGTCAACCCCGATATCTCAAACCACGGTGACCAATCT
CCGCTCTCTAGCTGCCGAGTATGGGCTTGATGGAGTAGTGAAGCTGCTGT
TGGAATGGGGGGGTGTCAGCCTAGAGATCCAGACAATGATGGCCGAACAC
CGCTCTTGTATGCTAGGCAGAATGGGCTCGATGGAGTAGTGAAGCTACTG
TTGGAATGGGGGGGGGTGTCAGC

Sequences in the Contig:

SY0AAB59YH09FM1