Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YH05FM1
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00000988001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: saccharopine dehydrogenase
Accession: ref|XP_001247784.1| Score: 432 E_value: 2e-59
KEGG Definition: saccharopine dehydrogenase Lys9, putative [EC:1.5.1.10]; K00293 saccharopine dehydrogenase (NADP+, L-glutamate forming)
Accession: afm:AFUA_4G11340 Score: 432 E_value: 1e-59
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0172 Score: 299 E_value: 2e-28
PFAM Definition: Saccharop_dh, Saccharopine dehydrogenase. This family comprised of three structural domains that can not be separated in the linear sequence. In some organisms this enzyme is found as a bifunctional polypeptide with lysine ketoglutarate reductase. The saccharopine dehydrogenase can also function as a saccharopine reductase..
Pfam Number: pfam03435 Score: 133 E_value: 5e-09
Swissprot: Q9P4R4|LYS9_MAGGR
Gene Ontology:
GO:0004755 = Molecular function: saccharopine dehydrogenase (NADP+, L-glutamate-forming) activity

Sequence:
>SY0AAB59YH05FM1
TTGGCGGAATTTGTCCGTACTCTCGTCGACACTGGATTCCTATCTGACGA
GCCTCTTGCCTTCCTTAAACCTTCTGACACCCCTCTCCCGTGGAAGACCG
CTCTAGCAAAGATCCTTGGGTCGTCCTCCGAGAAGGAGGAGGACCTCATT
TGGGCCATTTCTTCGAAGTCCAAATTCAGGGACAACGAGGAGAAGGAACG
TATCATCAATGGGATGAGGTGGCTGGGTATGTTCAGTGAGGTTAAGATCA
TACCAAGGGGTAACCCCTTAGACACCCTGTGTGCCACTCTGGAGGAGAAG
ATGCGGTATGGACCTGGGGAGCGTGACATGGTTATGCTGCAACACAGGTT
TGGTATTGAATCCGCCGATGGCTCTAAGATCGCCAGGAAACCCGTACCTC
TACCCTTGTAGAATATGGGGAGAGGGTAGGATATACCTCCATGGCCCGCC
TAGTTGGTATCCCATGTGCTGTGGCCGCCAAGTTGGTGCTCGACGGGACT
ATCTCGGATAAAGGGATTCTCGCTCCGGTTACAGAAAAGCTCTGTGATC

Sequences in the Contig:

SY0AAB59YH05FM1