Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YD12FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00001629001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_01757
Accession: ref|XP_001220978.1| Score: 243 E_value: 3e-19
KEGG Definition: hypothetical protein
Accession: ani:AN0821.2 Score: 241 E_value: 3e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB59YD12FM1
TTGGTCCGGATAATGTTACACTTACCTTTTCCATGATATTGTTTTTATCC
ACACCATCTTGCGTCAACCCAGCATGTCCATAGAGGTCAATTGGGAAACC
CTTACAGCTGGCCCAGACGGGGCTCGCTATGCGGAAAACATCCGCTCCTT
CGTGCACGAAAAGTTCCAATCCATTCCATTCCCCAAATTCATCAAATCAG
TCAATGTACACTCCTTCTCTTTCGGCAATGTGCCCCCGGACGTAGAGATC
AAAGAGCTCTGCGATCCTTACCCTGAATTCTATGAAGACGATGACGACGA
GTGCTCTGACTCCGATTCCGCCGATATTGATAACGGGAACGTCGGGGGTG
AGGACGAGCAGGATTATTTGCTCAAGCTTGAGAGGGAGCGGCGGAGGAGG
GAGAGAAGGGATGATGGCTATACCATTGGAGGTGCGAGAAGCCCTCCACC
GGGATTGAATCCCCCGCCTTATACGCCGGACGGCAGAACCGGGATCCCAT
TTCGGAGTCCATTCACACCTGGCATTCCGGATACTTTTCCGGGGAGAGTA
GGCGTTGCTGGAGTCACGACTCCATTATTTCATCGTGGGGGGAGTAGCTC
GAATTTACACTACTTTCAC

Sequences in the Contig:

SY0AAB59YD12FM1