Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB59YA15FM1
Length(NT) : 361
Best Gene Model Blast : Link to GSTUMT00001494001 E-value : 1e-152
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215590.1| Score: 171 E_value: 4e-11
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 155 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAB59YA15FM1
TTGGAACAAAACACAACCTCTTCCAATTTAGGGATCCATTGATAATATGG
GCAATCTACTATCAAACGTGCGCTCCTCGCACCAAGCCTCTATGGCCAAT
GGCTATATTCGTAGCGGCAACTCCGGTTCCTATGACATCTACTCTGGCGG
TGACGCGAACTCGTCCCCGAGCGATGCCGAAATTTTGCAATGCCTCTACA
CGTCTAGATACGAGGAGCACCGAAGTCGTGTTCGGGAGCCGGTCGAGGGA
ACATGCTCCTGGGTTGTTGACCATCCAAGGTATAAGGACTGGTTGAATGA
AAAGGCACTCAGTCTCCTCTGGCTGTCCGGGGACCCGGGTTGCGGAAAGT
CTGTCACGTCT

Sequences in the Contig:

SY0AAB59YA15FM1