Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YP23FM1
Length(NT) : 403
Best Gene Model Blast : Link to GSTUMT00005079001 E-value : 1e-160
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_08505
Accession: ref|XP_001226432.1| Score: 167 E_value: 1e-10
KEGG Definition: hypothetical protein
Accession: ang:An12g00730 Score: 157 E_value: 7e-10
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2734 Score: 146 E_value: 8e-11
PFAM Definition: No Hit Found

Sequence:
>SY0AAB58YP23FM1
TTGGTGGGGTCAGTCGTTGAAGAGGAGGAAATGGCTGAGGAGTGGTTCTC
CAAGAGATTGGACGCTGGGTTGTTTTGTCTACAGATGACCGATCGAATAC
TTGCCTGGTTATGCGCCGAAGACGACGGTGCTAAGAAGAGGATTGGTGGA
CTGCTGGGCAGGGCTGGTGGGAGCCTAAGGGATGTCAGGAGGACACTTAA
GGAACAAATCGATGGCATGACTGAAGCGTCAGATGAGTGGCAACAGGTTA
TCAAGGATATGCTCTCGACATTGATTGAATTTCTCTAGTCATTGTTTCTC
CTGTTATCTTAAGTTATTTTCTTCCATTCATTCCTTGTCATTTCTTTTTA
CCCCATCCATCGCTTCTCCTTTCCTTCCTCTTCCCCCCCATTCCCTCTTT
CCC

Sequences in the Contig:

SY0AAB58YP23FM1