Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YN21FM1
Length(NT) : 358
Best Gene Model Blast : Link to GSTUMT00000646001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_09007
Accession: ref|XP_001590243.1| Score: 550 E_value: 4e-55
KEGG Definition: hypothetical protein
Accession: fgr:FG05149.1 Score: 537 E_value: 6e-54
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0210 Score: 562 E_value: 3e-59
PFAM Definition: No Hit Found
Swissprot: P40527|ATC7_YEAST
Gene Ontology:
GO:0005768 = Cellular component: endosome
GO:0000139 = Cellular component: Golgi membrane
GO:0005515 = Molecular function: protein binding
GO:0006897 = Biological process: endocytosis
GO:0006890 = Biological process: retrograde vesicle-mediated transport, Golgi to ER
GO:0007033 = Biological process: vacuole organization and biogenesis

Sequence:
>SY0AAB58YN21FM1
CGGCGAATCACTCGCCCTCTTCCTGGACACGTACAAATCCGAGTTCATAT
CCCTCGCCGTACAGCTCCCGGCGGTAATTGCCTGCCGCTGCACCCCTACC
CAAAAGGCCGACGTGGCCCGGCTCATTCGTGCCTTCACCAAGAAGCGCAT
ATGCTGTATCGGTGATGGTGGGAACGACGTCTCCATGATCCAAGCGGCAG
ACGTAGGCGTCGGTATCGTCGGCAGGGAAGGCCGTCAGGCTAGTCTTGCG
GCGGACTTCAGTATCGAGCAATTCTGCCATCTAACAAAATTACTAGTATG
GCATGGAAGAAACTCGTATAAACGGAGTGCAAAGCTCGCGCAATTTGTTA
TGCACAGG

Sequences in the Contig:

SY0AAB58YN21FM1