Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YN04FM1
Length(NT) : 643
Best Gene Model Blast : Link to GSTUMT00002625001 E-value : 1e-159
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_05918
Accession: ref|XP_001555643.1| Score: 361 E_value: 2e-53
KEGG Definition: putative phosphoinositide phosphatase
Accession: aor:AO090023000764 Score: 342 E_value: 5e-52
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1889 Score: 289 E_value: 5e-27
PFAM Definition: No Hit Found
Swissprot: O60162|YG23_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>SY0AAB58YN04FM1
TTGGTGGAATGGCACAGGGCACAGCTACTTCTCGAACAGCTAGGTGGTGG
CCTATACGATCAACAATATTTTCATTCTGTTGAGGGAAAATTTGTGTCGA
GTGACATTCGGAGCTATCAGACGAGCGTTGTTAGGACTAACTGCATGGAC
TGCCTGGACAGGACAAACGTCGTGCAGAGCATGCTAGCCCGGCGAACCCT
GAATCGCCAGATGGTTGATGCTGGTGTTCTTGGGGAGGGAGAAAATACCG
CATCCTTCAATAGCTTTGAGGTCATATTCAGGAGCGGTGAGTCGGAGATC
GTCGTACAGGGCTTGGTGGAAGAGTGGAATTCTACTGACAGGATATTGTG
CTTCTTACTTTAGTATGGGCTGACAATGCGGATGTTGTGAGCCAGACGTA
TTCTGGCACTGGGGCACTGAAGACTGATCTCACAAGAACCGGAGTACGAA
CAAAGGCTGGAGCTATTGCGGATCTATCGAGCTCTATCACCCGATATTTC
CGTAACAATTTTAGTGATGGGCCACGGCAGGATGCGTACGATCTCTTTTT
AGGGGTCCATCTTCCCTCGTCAACCTCCATGTCCTCCCTACTGTTTATCG
ATCGCCGCCCGATAATGATTCAGAGCATTCCATATGTTCTTTG

Sequences in the Contig:

SY0AAB58YN04FM1