Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YJ18FM1
Length(NT) : 568
Best Gene Model Blast : Link to GSTUMT00000349001 E-value : 1e-134
Numbers of ESTs : 1

Blast Results:

Nr Definition: saccharopine reductase
Accession: gb|AAF91081.1|AF144424_1 Score: 365 E_value: 2e-33
KEGG Definition: saccharopine dehydrogenase [EC:1.5.1.10]; K00293 saccharopine dehydrogenase (NADP+, L-glutamate forming)
Accession: mgr:MGG_08564 Score: 365 E_value: 9e-34
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0172 Score: 278 E_value: 7e-26
PFAM Definition: Saccharop_dh, Saccharopine dehydrogenase. This family comprised of three structural domains that can not be separated in the linear sequence. In some organisms this enzyme is found as a bifunctional polypeptide with lysine ketoglutarate reductase. The saccharopine dehydrogenase can also function as a saccharopine reductase..
Pfam Number: pfam03435 Score: 262 E_value: 6e-24
Swissprot: Q9P4R4|LYS9_MAGGR
Gene Ontology:
GO:0004755 = Molecular function: saccharopine dehydrogenase (NADP+, L-glutamate-forming) activity

Sequence:
>SY0AAB58YJ18FM1
TTGGGTCTGGACACGATTGTTGGTGCGCCCTCTAGGGGCGGTACGTCTCT
CTGTCTCTCTGTCTTCCCTCTATTCTGCCATCCATTTGTTCATTCCCTCC
CAAACCCTTTTTTGTCTCTTTCGAGCAGAATAAGTTTCAAACCTCGACAG
TTTTCGTCCATTAAAATTCAACAACAATCCCGTACTCAAGGACTACACGA
TGACTCCAATCCTCCGATCGAATAGCTCCAAAGTCCTTCTTCTTGGCAGC
GGTTTCGTCGCGGGGCGGTGTCTTGGTGCCTTATCGGACTCTGACGTCGC
CGTCACTGTTGCCTGCCGTCATATCAAGGCTGCTGAGGAACTGGCTGAAG
GTGTCAGACACGCAACTGCCATCTCGCTTGACATTAACAATACCGACGCC
ATGGAGGCCGAAGTTGCAACGCACGATATTGTCATCAGTTTGGTTCCTTA
TGTCTACCACCCTCAGGTTATTAAAGCTGCTATTAAGGAAAGGAAGAATA
TTGTCACTACTTCTTATGTGAGCCCTGCTATGATAGAGCTTGACCAAGGG
GCCAAGGATGCCGGTATC

Sequences in the Contig:

SY0AAB58YJ18FM1