Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YJ12FM1
Length(NT) : 564
Best Gene Model Blast : Link to GSTUMT00006627001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: peroxisome biosynthesis protein (Peroxine-7), putative
Accession: ref|XP_001264218.1| Score: 416 E_value: 7e-54
KEGG Definition: peroxisome biosynthesis protein (Peroxine-7), putative
Accession: afm:AFUA_1G15400 Score: 414 E_value: 6e-54
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0277 Score: 386 E_value: 2e-38
PFAM Definition: No Hit Found
Swissprot: P39108|PEX7_YEAST
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005777 = Cellular component: peroxisome
GO:0005053 = Molecular function: peroxisome matrix targeting signal-2 binding
GO:0005515 = Molecular function: protein binding
GO:0016560 = Biological process: protein import into peroxisome matrix, docking

Sequence:
>SY0AAB58YJ12FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGAAGAGGCGGACGGTGGA
GTCTGAGGATGCGGTCGAGATTAAAGTTGGCGAATGTGGGGAGAAGAGCG
CGCTGTAGGTGCAACTGTGGATCGGGATCGTGAGAAGTGAGTGGGGGCTA
GTTGGTGACCACTTCCAAAGCATTAGTTACTTCCCCTGGTGCGGAAGACA
AGGGTGAACAAACAAGCTTAACATCCCCATCCCAACTAGAACTCACAAAC
CCGCTCTTATCTACTAAATTCCAACTGAGACAGAAAACCTCCCTCTTATG
CTCCCCCCAATTCGCGATCGGAAAAACCCCCTCCAACGCTGTATCGAACA
ATTTAATACTCCCGTCTCCACTCGCAACAGCAACCTGATTCTCGTGCGAC
TCGCTAAAGGTAACGTCAAAGAGCGAATCCTGCGTGTCGTAGTATCGCTC
GCAGATGATCCCCGTCGGAGTCAAAGAGAGTATGTATAATCGACCATTAC
CGACGAGGCCGAAGTTGGCGCTAGCGGCGGTCACGAGACGGTTGTCGTAG
AAGGGGGAGTACTT

Sequences in the Contig:

SY0AAB58YJ12FM1