Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YH22FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00011254001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein UM06494.1
Accession: ref|XP_762641.1| Score: 600 E_value: 1e-60
KEGG Definition: hypothetical protein [EC:6.1.1.5]; K01870 isoleucyl-tRNA synthetase
Accession: uma:UM06494.1 Score: 600 E_value: 6e-61
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0433 Score: 637 E_value: 2e-67
PFAM Definition: tRNA-synt_1, tRNA synthetases class I (I, L, M and V). Other tRNA synthetase sub-families are too dissimilar to be included..
Pfam Number: pfam00133 Score: 437 E_value: 3e-44
Swissprot: P73505|SYI_SYNY3
Gene Ontology:
GO:0005524 = Molecular function: ATP binding
GO:0004822 = Molecular function: isoleucine-tRNA ligase activity
GO:0006428 = Biological process: isoleucyl-tRNA aminoacylation

Sequence:
>SY0AAB58YH22FM1
TTGGCAGCACAGTGGTTTGCGGACGTTGATGTTATTAAAGATGTTTGTGT
CGACTCACTTAAAAATGTCGTGTTTGTTCCGTCTTCTGGTAGATCGAGGT
TGACATCTTATGTCAACAGCCGTTCGGAATGGTGTATTTCCCGTCAAAGG
GCCTGGGGAGTCCCTATTCCCGTGCTCTATGATATCGATACCAATGAACC
ATTACTGACTGGGGAAAGCGTTGAACATATCATTGGCATATTAGAAGAGA
AGGGCACTGATGCTTGGTGGGGGAGTGGAGTTCCGGAAGAAGCATGGGTA
CCAGAACCAATCAGAATGACAGGAAAGAGATACGCTCGAGGCAAGGAAAC
CATGGACGTCTGGTTCGATAGCGGCACAAGTTGGGCTATACTTAGAAGTC
GCATCGGACAGCGGGAGGGCAAGCCTTTGGCTGATCTTTACCTCGAGGGG
TCTGACCAGCACCGCGGCTGGTTTCAGTCATCGTTACTCACTTCGGTAGC
TACCACTACAGGTCTCAGTGCTGCTAAAACACCTTTTGCAATGGTTGTCA
CACATGGCTTCTGTTTGGATGAAAAGGGGAAGAAGATGTCAAAGTCT

Sequences in the Contig:

SY0AAB58YH22FM1