Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YG17FM1
Length(NT) : 669
Best Gene Model Blast : Link to GSTUMT00010961001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_06759
Accession: ref|XP_001554616.1| Score: 726 E_value: 4e-75
KEGG Definition: hypothetical protein [EC:3.6.1.-]; K01529
Accession: mgr:MGG_05032 Score: 701 E_value: 1e-72
KOG Definition:
Classification: [Transcription, Replication, recombination and repair].
Kog Number: KOG1001 Score: 307 E_value: 4e-29
PFAM Definition: SNF2_N, SNF2 family N-terminal domain. This domain is found in proteins involved in a variety of processes including transcription regulation (e.g., SNF2, STH1, brahma, MOT1), DNA repair (e.g., ERCC6, RAD16, RAD5), DNA recombination (e.g., RAD54), and chromatin unwinding (e.g., ISWI) as well as a variety of other proteins with little functional information (e.g., lodestar, ETL1)..
Pfam Number: pfam00176 Score: 174 E_value: 1e-13
Swissprot: Q4IJ84|RAD5_GIBZE

Sequence:
>SY0AAB58YG17FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTATCGTCAATCGGTTAGA
AGATCTTTTCAGTTTGGTAAGGTTTTTACGAGTTGAACCTTGGAGTAATT
TTTCCTTCTGGAAAACGTTTATCACAGTACCCTTTGAAGAAAAAGACTTC
ATAAGAGCTCTTGACGTCGTACAAACAGTCTTAGAGCCGCTAGTTCTACG
GAGAACAAAAGAGATGAAAACTCTTAATGGAGAGCCTCTTGTTCCTCTTC
CTAAGAAAACAACCGAGATTGTATACATAAAGCTTTCCAAAGCGGAGCTC
GATGTCTACAGGCATATTGAGGCTAGGGCAAGGAGCGATCTTGCTCGCAG
TATTGAGATGGGAACGGTTTTGAAGTCGTATACTAACATATTTGCACATG
TTCTCCGACTTAGACAAGCTTGTTGTCATCCGATATTGATTAGAAAGAAA
GAGATTGTCGATGATGAGATGATAGCTGAGGCTGAATATGATGCTGCTAA
GGGGTTCAGTGATGATATGGACTTGAACGCTTTAATAGATCAGTATTCGG
TTCAAGAAAATGATGCATTGCCTAATCTTTATGGTGCAAATGCTCTCAAA
GAGATTAGAGATAATGTAGAAAACGAATGTCCCATGTGTCTATCGGATCC
GATACCAGACCAAACTGTG

Sequences in the Contig:

SY0AAB58YG17FM1