Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAB58YE23FM1
Length(NT) : 672
Best Gene Model Blast : Link to GSTUMT00011320001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein An11g04520
Accession: ref|XP_001394444.1| Score: 334 E_value: 9e-37
KEGG Definition: hypothetical protein
Accession: ang:An11g04520 Score: 334 E_value: 5e-37
KOG Definition: No Hit Found
PFAM Definition: Ran-binding, RanGTP-binding protein. The small Ras-like GTPase Ran plays an essential role in the transport of macromolecules in and out of the nucleus and has been implicated in spindle and nuclear envelope formation during mitosis in higher eukaryotes. The S. cerevisiae ORF YGL164c encoding a novel RanGTP-binding protein, termed Yrb30p was identified. The protein competes with yeast RanBP1 (Yrb1p) for binding to the GTP-bound form of yeast Ran (Gsp1p) and is, like Yrb1p, able to form trimeric complexes with RanGTP and some of the karyopherins..
Pfam Number: pfam05508 Score: 254 E_value: 5e-23
Swissprot: P53107|YRB30_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0030695 = Molecular function: GTPase regulator activity
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAB58YE23FM1
TTGGTAGCAACGCTCCCAACACGGAATGGATTTCTTTCTTGCAAAAGTAT
CGCAACAAGCGGTTTCATTCGCGATACGGTCGGGCATCATTGTCACGAGT
CAGTTTGCTATAAAAGAATGCAGTCGTTATATATCTTCAATCAAGGGGAA
GGATAGACAAGAGCTTCAAGACCTACAGGATAGACTGGAACAGAAAATCA
GAGTCGGTCCCGATCTCAAGCGAGCTGGCTTTCCGCTGCTAACTGTTAGC
AGATAATATCTCCAGCAATAGACTTGGTGGAGATTATGTATGCCCCCCTG
GTTATGGAACTTCCCGCCTACCGGTTTGACTAAACTGAGCCATACAGTTC
TGCTAGAGGAAATACCTCACTTGAGAGTGCTCTGACATTGACGAAGAACA
TAAGACATGACATTCAATCACTAGGGGTCAGAGTTGCCGGCTTGTCCGCT
CAGGGAGGTGGCCGTAAAAGACGCAGGAGCCAGGATGAAATCAACGCTGT
GGTTCAAGATATCAAGCAACTTCTAAGGAAGATCGAAGACGCGGTTCCTT
TCATAAATTTGGCAATTACTACATCCGGAGTGAATATCTCATCGAACATC
CCACACAATGTCTCGCCTTCCCGTCTTATGCAAGCTTCAACCTTGCTTAC
TGCTGGTGATACCGCCTATTCA

Sequences in the Contig:

SY0AAB58YE23FM1